Assignment: Nucleotide Activity Questions

I’m working on a biology multi-part question and need an explanation and answer to help me learn.

1. Discuss the function in detail of each of the following RNA polymerase II transcription factors.
   1. TFIIB
   2. TFIIE
   3. TFIIF
   4. TFIIH
2. What additional role does one of the subunits of TFIIH have during the initiation phase that involves other protein kinases? What is the end result?
3. Discuss in detail how the 5’ cap is formed in eukarytotic mRNAs.
4. What makes the 3’ end of eukaryotic mRNAs unique? Describe how this is added.
5. What are the five snRNAs involved in splicing reaction, and describe briefly how they work to assemble spliceosomes.
6. What step in de novo purine nucleotide synthesis is the first committed step, and what happens in this step? Why is the carboxylation that takes place in step 6 of the de novo purine nucleotide synthesis unusual?
7. Describe three major feedback mechanisms that help to regulate the overall rate of de novo purine nucleotide synthesis and the relative rates of formation of the two end products, adenylate and guanylate.
8. How is thymidylate derived?
9. What causes Lesch-Nyhan Syndrome? What is the role of the enzyme that is lacking in individuals who have this disease?
10. Describe the condition known as Gout and include in your discussion how it is caused
11. What effect does the attenuation of hypoxanthine-guanine phosphoribosyl transferase (HGPRT) have on the de novo and salvage syntheses of purines?

1. Explain in detail the common feature of the biosynthesis of NAD+, FAD and Coenzyme A (CoA)
2. Define the following terms: codon, reading frame and peptide sequence (3 points)
3. Review the following coding DNA Sequence and its template strand, and provide the sequence
   for the corresponding mRNA strand in 5’ to 3’ orientation: (2 points)
   5’-CCGGCTAAGATCTGACTAGC-3’ (coding)
   3’-GGCCGATTCTAGACTGATCG-5’ (template)
4. Provide the 3 possible reading frames for the following mRNA sequence and identify any initiation
   or termination codons (5 points)
   5’- GCUAGUCAGAUCUUAGCCGG -3’
5. Consider the following mRNA sequence, translate each codon into its corresponding amino acid
   and provide the peptide sequence: (5 points)
   5’-CGG CUA AGA UCU GAC UAG -3’

The central dogma is a core concept that is one of the most critical for introductory biology and microbiology students to master, related to mutations, cancer, gene expression, development, and many other biological events. However, students often struggle to conceptualize the processes involved and fail to move beyond simply memorizing the basic facts. The constructivist model for learning proposes that more active approaches are more effective for learning. To encourage critical thinking, we have designed a set of magnetic nucleotides that allow students to model DNA structure, replication, transcription, and protein synthesis. Manipulatives have been used to teach molecular biology to students in a Clinical Laboratory Sciences program (2), and effectively in a freshman general biology course (1). Manipulatives should be especially effective at promoting kinesthetic learning.

Important information for writing discussion questions and participation

Welcome to class

Hello class and welcome to the class and I will be your instructor for this course. This is a -week course and requires a lot of time commitment, organization, and a high level of dedication. Please use the class syllabus to guide you through all the assignments required for the course. I have also attached the classroom policies to this announcement to know your expectations for this course. Please review this document carefully and ask me any questions if you do. You could email me at any time or send me a message via the “message” icon in halo if you need to contact me. I check my email regularly, so you should get a response within 24 hours. If you have not heard from me within 24 hours and need to contact me urgently, please send a follow up text to

I strongly encourage that you do not wait until the very last minute to complete your assignments. Your assignments in weeks 4 and 5 require early planning as you would need to present a teaching plan and interview a community health provider. I advise you look at the requirements for these assignments at the beginning of the course and plan accordingly. I have posted the YouTube link that explains all the class assignments in detail. It is required that you watch this 32-minute video as the assignments from week 3 through 5 require that you follow the instructions to the letter to succeed. Failure to complete these assignments according to instructions might lead to a zero. After watching the video, please schedule a one-on-one with me to discuss your topic for your project by the second week of class. Use this link to schedule a 15-minute session. Please, call me at the time of your appointment on my number. Please note that I will NOT call you.

Please, be advised I do NOT accept any assignments by email. If you are having technical issues with uploading an assignment, contact the technical department and inform me of the issue. If you have any issues that would prevent you from getting your assignments to me by the deadline, please inform me to request a possible extension. Note that working fulltime or overtime is no excuse for late assignments. There is a 5%-point deduction for every day your assignment is late. This only applies to approved extensions. Late assignments will not be accepted.

If you think you would be needing accommodations due to any reasons, please contact the appropriate department to request accommodations.

Plagiarism is highly prohibited. Please ensure you are citing your sources correctly using APA 7th edition. All assignments including discussion posts should be formatted in APA with the appropriate spacing, font, margin, and indents. Any papers not well formatted would be returned back to you, hence, I advise you review APA formatting style. I have attached a sample paper in APA format and will also post sample discussion responses in subsequent announcements.

Your initial discussion post should be a minimum of 200 words and response posts should be a minimum of 150 words. Be advised that I grade based on quality and not necessarily the number of words you post. A minimum of TWO references should be used for your initial post. For your response post, you do not need references as personal experiences would count as response posts. If you however cite anything from the literature for your response post, it is required that you cite your reference. You should include a minimum of THREE references for papers in this course. Please note that references should be no more than 5 years old except recommended as a resource for the class. Furthermore, for each discussion board question, you need ONE initial substantive response and TWO substantive responses to either your classmates or your instructor for a total of THREE responses. There are TWO discussion questions each week, hence, you need a total minimum of SIX discussion posts for each week. I usually post a discussion question each week. You could also respond to these as it would count towards your required SIX discussion posts for the week.

I understand this is a lot of information to cover in 5 weeks, however, the Bible says in Philippians 4:13 that we can do all things through Christ that strengthens us. Even in times like this, we are encouraged by God’s word that we have that ability in us to succeed with His strength. I pray that each and every one of you receives strength for this course and life generally as we navigate through this pandemic that is shaking our world today. Relax and enjoy the course!

Hi Class,

Please read through the following information on writing a Discussion question response and participation posts.

Contact me if you have any questions.

Important information on Writing a Discussion Question

• Your response needs to be a minimum of 150 words (not including your list of references)
• There needs to be at least TWO references with ONE being a peer reviewed professional journal article.
• Include in-text citations in your response
• Do not include quotes—instead summarize and paraphrase the information
• Follow APA-7th edition
• Points will be deducted if the above is not followed

Participation –replies to your classmates or instructor

• A minimum of 6 responses per week, on at least 3 days of the week.
• Each response needs at least ONE reference with citations—best if it is a peer reviewed journal article
• Each response needs to be at least 75 words in length (does not include your list of references)
• Responses need to be substantive by bringing information to the discussion or further enhance the discussion. Responses of “I agree” or “great post” does not count for the word count.
• Follow APA 7th edition
• Points will be deducted if the above is not followed

• Remember to use and follow APA-7th edition for all weekly assignments, discussion questions, and participation points.
• Here are some helpful links
• The is a great resource